Новости
01.01.2023
Поздравляем с Новым годом и Рождеством!
01.01.2022
Поздравляем Вас с Новым годом и Рождеством!
06.03.2021
Поздравляем с Международным женским днем!
Оплата онлайн
При оплате онлайн будет
удержана комиссия 3,5-5,5%








Способ оплаты:

С банковской карты (3,5%)
Сбербанк онлайн (3,5%)
Со счета в Яндекс.Деньгах (5,5%)
Наличными через терминал (3,5%)

ОСОБЕННОСТИ ГЕНОФОНДА КРУПНОГО РОГАТОГО СКОТА АУЛИЕКОЛЬСКОЙ ПОРОДЫ ПО МИКРОСАТТЕЛИТНЫМ ДНК

Авторы:
Город:
Шымкент
ВУЗ:
Дата:
11 февраля 2018г.
Аннотация

В данной работе представлены результаты генетического тестирования по 11 микросателлитным локусам ДНК крупного  рогатого скота аулиекольской породы.  Современная популяция аулиекольской породы имеет генетическое разнообразие по следующим показателям: среднее число аллелей 12,2, гетерозиготность – 0,8704, индекс фиксации индивидуальный (Fis) – 0,0216. Было идентифицировано 135 аллелей, из них типичных аллелей 123 (с частотой более 0,01) и приватных 12 (с частотой менее 0,01).

Ключевые  слова:  крупный  рогатый  скот,  аулиекольская  порода,  аллель,  микросателлиты, полиморфизм, генотипирование.

Введение

Аулиекольская порода крупного рогатого скота (КРС) была выведена в конце 20 веке в Казахстане путем скрещивания трех специализированных мясных пород – казахско белоголовой, шаролезской и абердин-ангусской [1].

В настоящее время оценка генетического разнообразия стала неотъемлемой частью селекционно- племенной работы. Анализ меж- и внутрипородного полиморфизма локусов ДНК проводится в большинстве пород и популяций животных с учетом континентального и регионального размещения.

Одним из наиболее информативных методов такого анализа является микросателлитное типирование, которое не только характеризует генетическую структуру популяций, пород, стад, и оценивает степень их генетического сходства, но и повышает эффективность селекции путем контроля за достоверностью происхождения [2,3,4].

Цель работы: оценка современного состояния генофонда аулиекольской породы крупного рогатого скота Казахстана по полиморфизму микросателлитных локусов ДНК.

Материалы и методы

Материалом служили биологические образцы (волосяные луковицы) 1834 голов животных из 15 хозяйств различных регионов Казахстана.

Выделение    ДНК     проводилось    в     соответствии    с     протоколом    производителя     реагентов.

Генотипирование крупного рогатого скота проводили набором StockMarks Cattle по 11 локусам (см. табл.1).

Идентификация продуктов амплификации выполнена на генетическом анализаторе ABI Prism 310 (Applied Biosystems, США) с применением капиллярного электрофореза и лазерной детекции. Расшифровка полученных графических результатов проводилась в программе GeneMapper 4.0. Для характеристики полиморфизма использовали следующие показатели: частоту аллелей и частоту генотипов, наблюдаемую и ожидаемую гетерозиготность с учетом закона Харди–Вайнберга, а также среднюю гетерозиготность по локусам, среднее число аллелей в локусе и индекс фиксации индивидуальный (Fis).

Таблица 1. Специфичные локусы для генотипирования крупного рогатого скота

 

Локусы

Хромосомная

локализация

Повторение

последовательности

Повторение праймеров

Длина

ампликонов

TGLA22

7

D18S1

(TG)n

F:GGAATTCCAAATCTGTTAATTTGCT

R:ACAGACAGAAACTCAATGAAAGCA

76-104

BM2113

D2S26

(CA)n

F:GCTGCCTTCTACCAAATACCC

R:CATTCCTGAGAGAAGCAACACC

124-146

TGLA53

D16S3

(TG)6 CG(TG)4 (TA)n

F:GCTTTCAGAAATGTTTGCATTCA

R:TCTTCACATGATATTACAGCAGA

151-187

ETH10

D5S3

(AC)n

F:GTTCAGGACTGGCCCTGCTAACA

R:CCTCCAGCCCACTTTCTCTTCTC

206-222

SPS115

D15

(CA)n TA(CA)6

F:AAAGTGACACAACAGCTTCACCAG

R:AACCGAGTGTCCTAGTTTGGCTGTG

247-261

TGLA12

6

D20S1

(TG)n

F:CTAATTTAGAATGAGAGAGGCTTCT

R:TTGGTCCTCTATTCTCTGAATATTCC

111-127

TGLA12

2

D21S6

(AC)n (AT)n

F:AATCACAGGCAAATAAGTACATAC

R:CCCTCCTCCAGGTAAATCAGC

136-182

INRA23

D3S10

(AC)n

F:GAGTAGAGCTACAAGATAAACTTC

R:TAACTACAGGGTGTTAGATGAACTC

201-225

ETH3

D19S2

(GT)6 AC(GT)n

F:GAACCTGCCTCTCCTGCATTGG

R:ACTCTGCCTGTGGCCAAGTAGG

100-128

ETH225

D9S2

(TG)4 CG(TG)(CA)n

F:GTACACCTTGCCACTATTTCCT

R:ACATGACAGCCAGCTGCTACT

139-157

BM1824

D1S34

(GT)n

F:GAGCAAGGTGTTTTTCCAATC

R:CTATCTCCAACTGCTTCCTTG

176-188

 

Все биометрические расчеты проводили согласно [5,6,7]. Для расчета популяционно-генетических показателей использовали статистический пакет [8] и программный комплекс собственной разработки на алгоритмическом языке Fortran PowerStation v.1.0 [9].

Результаты и обсуждение

Представлена характеристика аулиекольской породы КРС в контексте внутри породной дифференциации. Для общей характеристики и позиционирования данной породы предложены следующие результаты генотипирования 11 локусов, которые приведены в таблице 2 более подробно.

Таблица 2. Выявленные аллельные варианты у популяции крупного рогатого скота аулиекольской породы (размер выборки 1834 голов).

 

 

Локус

 

Число

 

 

аллелей

 

Типичные

 

 

аллели

 

Приватные

 

 

аллели

 

Гетерезиготность

 

He (ожидаемая)

 

Гетерезиготность Ho (наблюдаемая)

Fis

TGLA227

15

15

0

0,9012

0,9084

-0,0080

BM2113

14

12

2

0,9039

0,7939

0,1217

TGLA53

19

17

2

0,8892

0,8790

0,0115

ETH10

8

8

0

0,8548

0,8332

0,0253

SPS115

8

8

0

0,8642

0,8370

0,0315

TGLA126

9

9

0

0,8791

0,8315

0,0541

TGLA122

24

16

8

0,9181

0,9547

-0,0399

INRA23

13

13

0

0,8959

0,9013

-0,0060

ETH3

11

11

0

0,8050

0,7628

0,0524

ETH225

7

7

0

0,8407

0,8359

0,0057

BM1824

7

7

0

0,8463

0,8610

-0,0173

Сумма

135

123

12

9,5984

9,3986

0,2311

Среднее

значение

 

12,27

 

11,18

 

1,09

 

0,8726

 

0,8544

 

0,0210

 

В целом, проведенный анализ аллелофонда данной выборки крупного рогатого скота выявил спектр значений, характерный для аулиекольской породы КРС. Наиболее полиморфными для данной популяции из 11 МС локусов являются локусы TGLA227, BM2113, TGLA53, TGLA122, INRA23 с 15, 14, 19, 24 и 13 аллелями соответственно, наименее полиморфны локусы ETH225 и BM1824 (по 7 аллелей).




Рис.1 Доля типичных и приватных аллелей в 11 локусах аулиекольской породы. Темным тоном указана доля типичных аллелей, светлым - доля приватных аллелей.

 

Генетическое внутрипородное разнообразие (полиморфность) отражает наличие информативных и присутствие редких (приватных) аллелей. Всего было идентифицировано 135 аллелей, из них информативных - 123 и приватных – 12. Среднее число аллелей по всем локусам составило 12,27, по всем информативным аллелям - 11,18 и по приватным – 1,09 как указано на рисунке 1.

Уровень средней ожидаемой гетерозиготности КРС по локусам варьирует от 0,8050 (в локусе ETH3) до 0,9181 (TGLA122), средний показатель по всем локусам составляет 0,8726. Данная закономерность наблюдается и для уровней средней ожидаемой гетерозиготности как указано на рисунке 2.




По одниму из показателей популяционной диференциации, коэфициенту Fis (индивидуальный индекс фиксации), был обнаружен избыток гетрезигот в локусах TGLA227, TGLA122, INRA23 и BM1824.

Выводы

1.                   В отличие от других пород внутрипородная структура аулиекольской породы различается в аллельном спектре TGLA227, TGLA122, INRA23 и BM1824 (отчет отдела генетики сельскохозяйственных животных КазНИИЖиК).

2.                   Анализ исследуемых популяционно-генетических структур аулиекольской породы КРС подтвердил наличие дифференцированных групп животных в различных регионах Казахстана.

 

Список литературы

 

1.                   Данкверт С.А., Холманов А.М., Осадчая О.Ю. Скотоводство стран мира., - М., 2007. – 608 с.

2.                   Хлесткина Е.К Молекулярные маркеры в генетических исследованиях и в селекции // Вавиловский журнал генетики и селекции. - 2013. - Т. 17, №4/2. - С. 1044-1054.

3.                   Сулимова Г.Е. ДНК-маркеры в генетических исследованиях: типы маркеров, их свойства и области применения // Успехи современной биологии. - 2004. - Т. 124. - С. 260-271.

4.                   Глазко В.И, Гладырь Е.А., Феофилов А.В., Бардуков Н. В., Глазко Т.Т. ISSR-PCR маркеры и мобильные генетические элементы сельскохозяйственных видов млекопитающих // Сельско- хозяйственная биология. - 2013. - №2. - С. 71-76.

5.                   Хедрик Ф. Генетика популяций. М: Техносфера, 2013.,592 с.

6.                   Вейр. Б. Анализ генетических данных. М.: Мир, 1995., 399 с.

7.                   Животовский Л.А. Популяционная биометрия.М.: Наука, 1991., 267 с.

8.                   Статистический пакет SPSS Statistics v.17, http:/www.spss.com

9.                   Нурбаев С.Д., Омбаев А.М., Каратаева М.Б., Тугельбаева А.К., Хамзина Ж.М., Кобикбаева А.М. Авторское свидетельство «Автоматизированное рабочее место зоотехника селекционера (программа для ЭВМ». Запись в реестре за №2122 от 8.09.2017 Министерство юстиции РК.